Repeat PCR testing concentrating on sufferers with pulmonary CT findings suggestive

Frequency of serological non-responders and false-negative RT-PCR leads to SARS-CoV-2 testing: a population-based research

Aims The sensitivity of molecular and serological strategies for COVID-19 testing in an epidemiological setting is just not effectively described. The intention of the research was to find out the frequency of damaging RT-PCR outcomes at first scientific presentation in addition to damaging serological outcomes after a follow-up of at the least Three weeks. Strategies Amongst all sufferers seen for suspected COVID-19 in Liechtenstein (n=1921), we included initially RT-PCR constructive index sufferers (n=85) in addition to initially RT-PCR damaging (n=66) for follow-up with SARS-CoV-2 antibody testing.

Antibodies have been detected with seven completely different commercially accessible immunoassays. Frequencies of damaging RT-PCR and serology leads to people with COVID-19 have been decided and in comparison with these noticed in a validation cohort of Swiss sufferers (n=211).

Outcomes Amongst COVID-19 sufferers in Liechtenstein, false-negative RT-PCR at preliminary presentation was seen in 18% (12/66), whereas damaging serology in COVID-19 sufferers was 4% (3/85). The validation cohort confirmed related frequencies: 2/66 (3%) for damaging serology, and 16/155 (10%) for false damaging RT-PCR. COVID-19 sufferers with damaging follow-up serology tended to have an extended illness length (p=0.05) and extra scientific signs than different sufferers with COVID-19 (p<0.05).

The antibody titer from quantitative immunoassays was positively related to the variety of illness signs and illness length (p<0.001). Conclusions RT-PCR at preliminary presentation in sufferers with suspected COVID-19 can miss contaminated sufferers. Antibody titers of SARS-CoV-2 assays are linked to the variety of illness signs and the length of illness. One in 25 sufferers with RT-PCR-positive COVID-19 doesn’t develop antibodies detectable with incessantly employed and commercially accessible immunoassays.

Anti-GPR119 antibody
STJ11100495	St John's Laboratory	100 µl	EUR 277

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Polyclonal Goat Anti-GPR119 Antibody
APR16300G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR119 . This antibody is tested and proven to work in the following applications:

GPR119 antibody
70R-31399	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal GPR119 antibody

GPR119 Antibody
ABD4892	Lifescience Market	100 ug	EUR 438

GPR119 Antibody
DF4892	Affbiotech	200ul	EUR 304
Description: GPR119 Antibody detects endogenous levels of total GPR119.

GPR119 Antibody
1-CSB-PA007283	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR119. Recognizes GPR119 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

Gpr119/ Rat Gpr119 ELISA Kit
ELI-08203r	Lifescience Market	96 Tests	EUR 886

GPR119 Polyclonal Antibody
ES4819-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 Polyclonal Antibody
ES4819-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 Polyclonal Antibody
ABP53820-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240 Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody
ABP53820-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240 Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody
ABP53820-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240 Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody
40973-100ul	SAB	100ul	EUR 252

GPR119 Polyclonal Antibody
40973-50ul	SAB	50ul	EUR 187

GPR119 siRNA
20-abx902267	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR119 siRNA
20-abx918416	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR119 siRNA
20-abx918417	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR119 Polyclonal Conjugated Antibody
C40973	SAB	100ul	EUR 397

GPR119 Blocking Peptide
20-abx162463	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

GPR119 Rabbit pAb
A18544-100ul	Abclonal	100 ul	EUR 308

GPR119 Rabbit pAb
A18544-200ul	Abclonal	200 ul	EUR 459

GPR119 Rabbit pAb
A18544-20ul	Abclonal	20 ul	EUR 183

GPR119 Rabbit pAb
A18544-50ul	Abclonal	50 ul	EUR 223

GPR119 Blocking Peptide
DF4892-BP	Affbiotech	1mg	EUR 195

GPR119 cloning plasmid
CSB-CL840575HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1008 Sequence: atggaatcatctttctcatttggagtgatccttgctgtcctggcctccctcatcattgctactaacacactagtggctgtggctgtgctgctgttgatccacaagaatgatggtgtcagtctctgcttcaccttgaatctggctgtggctgacaccttgattggtgtggccatct Show more
Description: A cloning plasmid for the GPR119 gene.

Polyclonal GPR119 Antibody (aa186-235)
APR16477G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (aa186-235). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)
APR16478G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)
APR16479G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

Rat GPR119 shRNA Plasmid
20-abx989158	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GPR119 shRNA Plasmid
20-abx965265	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Gpr119 ELISA KIT
ELI-09750m	Lifescience Market	96 Tests	EUR 865

Human GPR119 ELISA KIT
ELI-48829h	Lifescience Market	96 Tests	EUR 824

Mouse GPR119 shRNA Plasmid
20-abx982252	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GPR119 Recombinant Protein (Human)
RP039541	ABM	100 ug	Ask for price

GPR119 Recombinant Protein (Rat)
RP203282	ABM	100 ug	Ask for price

GPR119 Recombinant Protein (Mouse)
RP139418	ABM	100 ug	Ask for price

G-Protein Coupled Receptor 119 (GPR119) Antibody
20-abx121407	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

G Protein-Coupled Receptor 119 (GPR119) Antibody
20-abx324143	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody
abx215630-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody
abx432763-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Gpr119 ORF Vector (Rat) (pORF)
ORF067762	ABM	1.0 ug DNA	EUR 506

Gpr119 ORF Vector (Mouse) (pORF)
ORF046474	ABM	1.0 ug DNA	EUR 506

GPR119 ORF Vector (Human) (pORF)
ORF013181	ABM	1.0 ug DNA	EUR 354

GPR119 sgRNA CRISPR Lentivector set (Human)
K0895801	ABM	3 x 1.0 ug	EUR 339

Gpr119 sgRNA CRISPR Lentivector set (Mouse)
K3605701	ABM	3 x 1.0 ug	EUR 339

Gpr119 sgRNA CRISPR Lentivector set (Rat)
K7204201	ABM	3 x 1.0 ug	EUR 339

GPR119 sgRNA CRISPR Lentivector (Human) (Target 1)
K0895802	ABM	1.0 ug DNA	EUR 154

GPR119 sgRNA CRISPR Lentivector (Human) (Target 2)
K0895803	ABM	1.0 ug DNA	EUR 154

GPR119 sgRNA CRISPR Lentivector (Human) (Target 3)
K0895804	ABM	1.0 ug DNA	EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3605702	ABM	1.0 ug DNA	EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3605703	ABM	1.0 ug DNA	EUR 154

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3605704	ABM	1.0 ug DNA	EUR 154

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7204202	ABM	1.0 ug DNA	EUR 154

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7204203	ABM	1.0 ug DNA	EUR 154

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7204204	ABM	1.0 ug DNA	EUR 154

GPR119 Protein Vector (Human) (pPB-C-His)
PV052721	ABM	500 ng	EUR 481

GPR119 Protein Vector (Human) (pPB-N-His)
PV052722	ABM	500 ng	EUR 481

GPR119 Protein Vector (Human) (pPM-C-HA)
PV052723	ABM	500 ng	EUR 481

GPR119 Protein Vector (Human) (pPM-C-His)
PV052724	ABM	500 ng	EUR 481

GPR119 Protein Vector (Mouse) (pPB-C-His)
PV185894	ABM	500 ng	EUR 603

GPR119 Protein Vector (Mouse) (pPB-N-His)
PV185895	ABM	500 ng	EUR 603

GPR119 Protein Vector (Mouse) (pPM-C-HA)
PV185896	ABM	500 ng	EUR 603

GPR119 Protein Vector (Mouse) (pPM-C-His)
PV185897	ABM	500 ng	EUR 603

GPR119 Protein Vector (Rat) (pPB-C-His)
PV271046	ABM	500 ng	EUR 603

GPR119 Protein Vector (Rat) (pPB-N-His)
PV271047	ABM	500 ng	EUR 603

GPR119 Protein Vector (Rat) (pPM-C-HA)
PV271048	ABM	500 ng	EUR 603

GPR119 Protein Vector (Rat) (pPM-C-His)
PV271049	ABM	500 ng	EUR 603

Gpr119 3'UTR Luciferase Stable Cell Line
TU205325	ABM	1.0 ml	Ask for price

Gpr119 3'UTR GFP Stable Cell Line
TU158968	ABM	1.0 ml	Ask for price

GPR119 3'UTR Luciferase Stable Cell Line
TU009210	ABM	1.0 ml	EUR 2333

Gpr119 3'UTR Luciferase Stable Cell Line
TU108968	ABM	1.0 ml	Ask for price

GPR119 3'UTR GFP Stable Cell Line
TU059210	ABM	1.0 ml	EUR 2333

Gpr119 3'UTR GFP Stable Cell Line
TU255325	ABM	1.0 ml	Ask for price

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV629167	ABM	1.0 ug DNA	EUR 682

GPR119 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV629171	ABM	1.0 ug DNA	EUR 682

GPR119 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV629172	ABM	1.0 ug DNA	EUR 682

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0895805	ABM	3 x 1.0 ug	EUR 376

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3605705	ABM	3 x 1.0 ug	EUR 376

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7204205	ABM	3 x 1.0 ug	EUR 376

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0895806	ABM	1.0 ug DNA	EUR 167

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0895807	ABM	1.0 ug DNA	EUR 167

GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0895808	ABM	1.0 ug DNA	EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3605706	ABM	1.0 ug DNA	EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3605707	ABM	1.0 ug DNA	EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3605708	ABM	1.0 ug DNA	EUR 167

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV629168	ABM	1.0 ug DNA	EUR 682

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV629169	ABM	1.0 ug DNA	EUR 740

GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV629170	ABM	1.0 ug DNA	EUR 740

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7204206	ABM	1.0 ug DNA	EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7204207	ABM	1.0 ug DNA	EUR 167

Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7204208	ABM	1.0 ug DNA	EUR 167

Anti-Anti-SEPT2 Antibody antibody
STJ28365	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ28963	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody
STJ11100949	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody
STJ25475	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ25477	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody
STJ25479	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody
STJ111369	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody
STJ111530	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT4 Antibody antibody
STJ112276	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody
STJ112609	St John's Laboratory	100 µl	EUR 277

When ought to clinicians repeat SARS-CoV-2 RT-PCR?: Repeat PCR testing concentrating on sufferers with pulmonary CT findings suggestive of COVID-19

Actual-time reverse transcription polymerase chain response (RT-PCR) testing for SARS-CoV-2 is usually repeated when clinicians suspect a false-negative consequence, however the situations beneath which repeated RT-PCR testing is warranted stay unclear.

We evaluated the apply of repeat RT-PCR testing for SARS-CoV-2 in 45 sufferers who retested after an preliminary damaging PCR take a look at. Of those, the analysis of coronavirus illness (COVID-19) was confirmed in 4 sufferers with typical chest computed tomography (CT) findings, and one affected person with out typical CT findings in whom the take a look at consequence was strongly suspected to be false constructive. We suggest repeat RT-PCR just for sufferers with typical CT findings of COVID-19.

A survey of gastrointestinal nematode species in purple deer (Cervus elaphus) farms in New Zealand utilizing PCR

Gastrointestinal nematodes are recognised as an animal well being concern for farmed purple deer. The intention of this research was to discover the vary of species infecting farmed deer herds and their farm-level prevalence in New Zealand. Faecal samples have been collected from 12-24-month-old deer (n = 6-26; imply 19) on 59 farms situated within the North (n = 25) and South (n = 34) Islands. Sub-samples of faeces have been pooled by farm and cultured to recuperate third stage larvae. Twenty 4 larvae have been randomly chosen and recognized to species utilizing a multiplex PCR (complete = 1217 larvae).

• At farm-level probably the most prevalent nematodes have been Oesophagostomum venulosum 83% (n = 49) and the deer-specific nematodes within the subfamily Ostertagiinae (=Ostertagia-type) together with, Spiculoptera asymmetrica 73% (n = 43), Ostertagia leptospicularis 47% (n = 28), Spiculoptera spiculoptera 47% (n = 28).
  
• The not too long ago recognized Trichostrongylus askivali was current on 32% (n = 19) of the farms and Oesophagostomum sikae on 17% (n = 10). Within the evaluation of the overall variety of larvae recognized, the proportion was in related order, 45% (n = 548) have been O. venulosum, 14% (n = 173) S. asymmetrica, 10% (n = 124) S. spiculoptera, 9% (n = 114) O. leptospicularis, T. askivali, 3% (n = 40) and solely 2% have been O. sikae (n = 20).
  
• This research is the primary to point out the farm-level prevalence of nematode species in deer in New Zealand and the primary to make use of PCR as a diagnostic device.
  
• It offers knowledge in step with cross-infection from sheep/cattle to deer, and offered tentative insights into the proportions of the principle GIN species throughout the deer inhabitants together with O. sikae and T. askivali which have solely not too long ago been recognized in New Zealand.

anti-GPCR GPR110
YF-PA22868	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GPCR GPR110

GPR110 antibody
70R-31396	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal GPR110 antibody

GPR110 Antibody
44961-100ul	SAB	100ul	EUR 252

GPR110 Antibody
44961-50ul	SAB	50ul	EUR 187

GPR110 Antibody
1-CSB-PA002753	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR110. Recognizes GPR110 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000

GPR110 Antibody
DF2796	Affbiotech	200ul	EUR 304
Description: GPR110 antibody detects endogenous levels of total GPR110.

GPR110 Antibody
DF4891	Affbiotech	200ul	EUR 304
Description: GPR110 Antibody detects endogenous levels of total GPR110.

GPR110 antibody
70R-51217	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal GPR110 antibody

GPR110 Antibody
ABD2796	Lifescience Market	100 ug	EUR 438

GPR110 Antibody
ABD4891	Lifescience Market	100 ug	EUR 438

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Polyclonal GPR110 Antibody
APR12205G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR110 . This antibody is tested and proven to work in the following applications:

GPR110 Conjugated Antibody
C44961	SAB	100ul	EUR 397

GPR110 Polyclonal Antibody
ABP51449-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890 Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody
ABP51449-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890 Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody
ABP51449-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890 Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody
ES2448-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 Polyclonal Antibody
ES2448-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 siRNA
20-abx918404	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR110 siRNA
20-abx918405	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR110 Blocking Peptide
DF2796-BP	Affbiotech	1mg	EUR 195

GPR110 Blocking Peptide
DF4891-BP	Affbiotech	1mg	EUR 195

GPR110 Blocking Peptide
20-abx064092	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Mouse GPR110 shRNA Plasmid
20-abx978802	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GPR110 shRNA Plasmid
20-abx966836	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

GPR110 ORF Vector (Human) (pORF)
ORF020338	ABM	1.0 ug DNA	EUR 405

Gpr110 ORF Vector (Mouse) (pORF)
ORF046467	ABM	1.0 ug DNA	EUR 506

G Protein-Coupled Receptor 110 (GPR110) Antibody
20-abx007923	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody
20-abx015251	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody
20-abx147426	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Gpr110 sgRNA CRISPR Lentivector set (Mouse)
K3842201	ABM	3 x 1.0 ug	EUR 339

GPR110 sgRNA CRISPR Lentivector set (Human)
K0894901	ABM	3 x 1.0 ug	EUR 339

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3842202	ABM	1.0 ug DNA	EUR 154

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3842203	ABM	1.0 ug DNA	EUR 154

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3842204	ABM	1.0 ug DNA	EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 1)
K0894902	ABM	1.0 ug DNA	EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 2)
K0894903	ABM	1.0 ug DNA	EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 3)
K0894904	ABM	1.0 ug DNA	EUR 154

GPR110 Protein Vector (Mouse) (pPB-C-His)
PV185866	ABM	500 ng	EUR 1065

GPR110 Protein Vector (Mouse) (pPB-N-His)
PV185867	ABM	500 ng	EUR 1065

GPR110 Protein Vector (Mouse) (pPM-C-HA)
PV185868	ABM	500 ng	EUR 1065

GPR110 Protein Vector (Mouse) (pPM-C-His)
PV185869	ABM	500 ng	EUR 1065

GPR110 Protein Vector (Human) (pPB-C-His)
PV081349	ABM	500 ng	EUR 552

GPR110 Protein Vector (Human) (pPB-N-His)
PV081350	ABM	500 ng	EUR 552

GPR110 Protein Vector (Human) (pPM-C-HA)
PV081351	ABM	500 ng	EUR 552

GPR110 Protein Vector (Human) (pPM-C-His)
PV081352	ABM	500 ng	EUR 552

Gpr110 3'UTR Luciferase Stable Cell Line
TU108961	ABM	1.0 ml	Ask for price

Gpr110 3'UTR GFP Stable Cell Line
TU158961	ABM	1.0 ml	Ask for price

GPR110 3'UTR GFP Stable Cell Line
TU059201	ABM	1.0 ml	EUR 1521

GPR110 3'UTR Luciferase Stable Cell Line
TU009201	ABM	1.0 ml	EUR 1521

Mouse G- protein coupled receptor 110, Gpr110 ELISA KIT
ELI-09748m	Lifescience Market	96 Tests	EUR 865

Human Probable G- protein coupled receptor 110, GPR110 ELISA KIT
ELI-08749h	Lifescience Market	96 Tests	EUR 824

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3842205	ABM	3 x 1.0 ug	EUR 376

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0894905	ABM	3 x 1.0 ug	EUR 376

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3842206	ABM	1.0 ug DNA	EUR 167

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3842207	ABM	1.0 ug DNA	EUR 167

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3842208	ABM	1.0 ug DNA	EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0894906	ABM	1.0 ug DNA	EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0894907	ABM	1.0 ug DNA	EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0894908	ABM	1.0 ug DNA	EUR 167

Anti-Anti-SEPT6 antibody antibody
STJ11100949	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody
STJ111369	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody
STJ111530	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT4 Antibody antibody
STJ112276	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody
STJ25475	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ25477	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody
STJ25479	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody
STJ28365	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ28963	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody
STJ112609	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ113941	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ114081	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ114819	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody
STJ114828	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ116214	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody
STJ117206	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody
STJ117759	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody
STJ118549	St John's Laboratory	100 µl	EUR 277

Anti-Anti-MARCH6 Antibody antibody
STJ118550	St John's Laboratory	100 µl	EUR 277

Anti-Anti-MARCH7 Antibody antibody
STJ118752	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT3 Antibody antibody
STJ118990	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT1 antibody antibody
STJ119580	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody
A00333	BosterBio	100uL	EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
4-AEA465Hu	Cloud-Clone	EUR 5698.00 EUR 3011.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies Sperm Antibodies Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)
ELK8071	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody
A06562	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody
A06569	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody
A06585-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody
A06587	BosterBio	100ug/vial	EUR 294

Anti-GluR8 Antibody
A06589	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody
A06597-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody
A06605-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody
A06627	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody
A06628-2	BosterBio	100ug/vial	EUR 294

Anti-GP2 Antibody
A06630-1	BosterBio	100ug/vial	EUR 334

Anti-USP21 Antibody
A06639	BosterBio	100ug/200ul	EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK2 Antibody
A06645	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.

Anti-PPP1R3C Antibody
A06658	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.

Anti-LRRK1 Antibody
A06670	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.

Anti-MNDA Antibody
A06675	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

Anti-KAL1 Antibody
A06684	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.

Anti-COL14A1 Antibody
A06685	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.

Anti-CYP4B1 Antibody
A06690	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CYP4B1 Antibody (CYP4B1) detection.tested for WB in Human.

Anti-RFX2 Antibody
A06709	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RFX2 Antibody. Validated in IHC and tested in Human.

Anti-GPR92 Antibody
A06721	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for GPR92 Antibody (LPAR5) detection. Tested for WB, IHC, IF in Human.

Anti-MBTPS1 Antibody
A06735	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MBTPS1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PLA2G1B Antibody
A06738	BosterBio	100ug/200ul	EUR 397
Description: Goat Polyclonal PLA2G1B Antibody. Validated in WB and tested in Human.

Anti-GNB5 Antibody
A06754	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GNB5 Antibody. Validated in IHC, WB and tested in Human.

Anti-BAIAP2L1 Antibody
A06770	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal BAIAP2L1 Antibody. Validated in WB and tested in Human.

Anti-IRTKS Antibody
A06770-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for IRTKS Antibody (BAIAP2L1) detection.tested for WB in Human, Mouse, Rat.

Anti-MLF1 Antibody
A06772	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MLF1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-NDR2 Antibody
A06774	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for NDR2 Antibody (STK38L) detection.tested for WB in Human, Mouse, Rat.

Anti-LARG Antibody
A06802-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for LARG Antibody (ARHGEF12) detection. Tested with WB in Human, Mouse, Rat.

Anti-GAS1 Antibody
A06815-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal GAS1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-APLF Antibody
A06828-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

Anti-PKCB1 Antibody
A06830	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal PKCB1 Antibody. Validated in WB and tested in Human.

Anti-DnaJB4 Antibody
A06835-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for DnaJB4 Antibody (DNAJB4) detection.tested for WB in Human, Mouse, Rat.

Anti-ArfGAP3 Antibody
A06839	BosterBio	100uL	EUR 455
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-SCN2B Antibody
A06842	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal SCN2B Antibody. Validated in WB and tested in Human.

Anti-CD316 Antibody
A06844	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CD316 Antibody (IGSF8) detection. Tested with WB in Human, Mouse.

Anti-AMOTL2 Antibody
A06852	BosterBio	100ug/vial	EUR 294

Anti-POM121 Antibody
A06856	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TBX22 Antibody
A06861	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal TBX22 Antibody. Validated in WB and tested in Human.

Anti-QORX Antibody
A06870	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal QORX Antibody. Validated in WB and tested in Human.

Anti-ADAM28 Antibody
A06873-1	BosterBio	100ug/vial	EUR 294

Anti-Adam28 Antibody
A06873-2	BosterBio	100ug/vial	EUR 334

Anti-KSR2 Antibody
A06876	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal KSR2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-Recoverin Antibody
A06882	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Recoverin Antibody (RCVRN) detection.tested for WB in Human, Mouse.

Anti-CRP1 Antibody
A06894	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal CRP1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-CD297 Antibody
A06913	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CD297 Antibody (ART4) detection.tested for IHC in Human.

Anti-TAF12 Antibody
A06944-1	BosterBio	100ug/vial	EUR 334

Anti-AKR7A2 Antibody
A06949-1	BosterBio	100ug/vial	EUR 334

Anti-IPMK Antibody
A06955	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal IPMK Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-ARHGEF10 Antibody
A06958	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for ARHGEF10 Antibody (ARHGEF10) detection.tested for WB in Human, Monkey.

Anti-BMP10 Antibody
A06968	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal BMP10 Antibody. Validated in WB and tested in Human.