Repeat PCR testing concentrating on sufferers with pulmonary CT findings suggestive

Frequency of serological non-responders and false-negative RT-PCR leads to SARS-CoV-2 testing: a population-based research

Aims The sensitivity of molecular and serological strategies for COVID-19 testing in an epidemiological setting is just not effectively described. The intention of the research was to find out the frequency of damaging RT-PCR outcomes at first scientific presentation in addition to damaging serological outcomes after a follow-up of at the least Three weeks. Strategies Amongst all sufferers seen for suspected COVID-19 in Liechtenstein (n=1921), we included initially RT-PCR constructive index sufferers (n=85) in addition to initially RT-PCR damaging (n=66) for follow-up with SARS-CoV-2 antibody testing.

Antibodies have been detected with seven completely different commercially accessible immunoassays. Frequencies of damaging RT-PCR and serology leads to people with COVID-19 have been decided and in comparison with these noticed in a validation cohort of Swiss sufferers (n=211).

Outcomes Amongst COVID-19 sufferers in Liechtenstein, false-negative RT-PCR at preliminary presentation was seen in 18% (12/66), whereas damaging serology in COVID-19 sufferers was 4% (3/85). The validation cohort confirmed related frequencies: 2/66 (3%) for damaging serology, and 16/155 (10%) for false damaging RT-PCR. COVID-19 sufferers with damaging follow-up serology tended to have an extended illness length (p=0.05) and extra scientific signs than different sufferers with COVID-19 (p<0.05).

The antibody titer from quantitative immunoassays was positively related to the variety of illness signs and illness length (p<0.001). Conclusions RT-PCR at preliminary presentation in sufferers with suspected COVID-19 can miss contaminated sufferers. Antibody titers of SARS-CoV-2 assays are linked to the variety of illness signs and the length of illness. One in 25 sufferers with RT-PCR-positive COVID-19 doesn’t develop antibodies detectable with incessantly employed and commercially accessible immunoassays.

Anti-GPR119 antibody
STJ11100495 100 µl
EUR 277
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Polyclonal Goat Anti-GPR119 Antibody
APR16300G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR119 . This antibody is tested and proven to work in the following applications:
GPR119 antibody
70R-31399 100 ug
EUR 327
Description: Rabbit polyclonal GPR119 antibody
GPR119 Antibody
ABD4892 100 ug
EUR 438
GPR119 Antibody
DF4892 200ul
EUR 304
Description: GPR119 Antibody detects endogenous levels of total GPR119.
GPR119 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR119. Recognizes GPR119 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000
Gpr119/ Rat Gpr119 ELISA Kit
ELI-08203r 96 Tests
EUR 886
GPR119 Polyclonal Antibody
ES4819-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
GPR119 Polyclonal Antibody
ES4819-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
GPR119 Polyclonal Antibody
ABP53820-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
GPR119 Polyclonal Antibody
ABP53820-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
GPR119 Polyclonal Antibody
ABP53820-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
GPR119 Polyclonal Antibody
40973-100ul 100ul
EUR 252
GPR119 Polyclonal Antibody
40973-50ul 50ul
EUR 187
GPR119 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR119 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR119 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR119 Polyclonal Conjugated Antibody
C40973 100ul
EUR 397
GPR119 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
GPR119 Rabbit pAb
A18544-100ul 100 ul
EUR 308
GPR119 Rabbit pAb
A18544-200ul 200 ul
EUR 459
GPR119 Rabbit pAb
A18544-20ul 20 ul
EUR 183
GPR119 Rabbit pAb
A18544-50ul 50 ul
EUR 223
GPR119 Blocking Peptide
DF4892-BP 1mg
EUR 195
GPR119 cloning plasmid
CSB-CL840575HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atggaatcatctttctcatttggagtgatccttgctgtcctggcctccctcatcattgctactaacacactagtggctgtggctgtgctgctgttgatccacaagaatgatggtgtcagtctctgcttcaccttgaatctggctgtggctgacaccttgattggtgtggccatct
  • Show more
Description: A cloning plasmid for the GPR119 gene.
Polyclonal GPR119 Antibody (aa186-235)
APR16477G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (aa186-235). This antibody is tested and proven to work in the following applications:
Polyclonal GPR119 Antibody (Cytoplasmic Domain)
APR16478G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal GPR119 Antibody (Cytoplasmic Domain)
APR16479G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
Rat GPR119 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GPR119 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Gpr119 ELISA KIT
ELI-09750m 96 Tests
EUR 865
ELI-48829h 96 Tests
EUR 824
Mouse GPR119 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GPR119 Recombinant Protein (Human)
RP039541 100 ug Ask for price
GPR119 Recombinant Protein (Rat)
RP203282 100 ug Ask for price
GPR119 Recombinant Protein (Mouse)
RP139418 100 ug Ask for price
G-Protein Coupled Receptor 119 (GPR119) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
G Protein-Coupled Receptor 119 (GPR119) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
G-Protein Coupled Receptor 119 (GPR119) Antibody
abx215630-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
G-Protein Coupled Receptor 119 (GPR119) Antibody
abx432763-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Gpr119 ORF Vector (Rat) (pORF)
ORF067762 1.0 ug DNA
EUR 506
Gpr119 ORF Vector (Mouse) (pORF)
ORF046474 1.0 ug DNA
EUR 506
GPR119 ORF Vector (Human) (pORF)
ORF013181 1.0 ug DNA
EUR 354
GPR119 sgRNA CRISPR Lentivector set (Human)
K0895801 3 x 1.0 ug
EUR 339
Gpr119 sgRNA CRISPR Lentivector set (Mouse)
K3605701 3 x 1.0 ug
EUR 339
Gpr119 sgRNA CRISPR Lentivector set (Rat)
K7204201 3 x 1.0 ug
EUR 339
GPR119 sgRNA CRISPR Lentivector (Human) (Target 1)
K0895802 1.0 ug DNA
EUR 154
GPR119 sgRNA CRISPR Lentivector (Human) (Target 2)
K0895803 1.0 ug DNA
EUR 154
GPR119 sgRNA CRISPR Lentivector (Human) (Target 3)
K0895804 1.0 ug DNA
EUR 154
Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3605702 1.0 ug DNA
EUR 154
Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3605703 1.0 ug DNA
EUR 154
Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3605704 1.0 ug DNA
EUR 154
Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7204202 1.0 ug DNA
EUR 154
Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7204203 1.0 ug DNA
EUR 154
Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7204204 1.0 ug DNA
EUR 154
GPR119 Protein Vector (Human) (pPB-C-His)
PV052721 500 ng
EUR 481
GPR119 Protein Vector (Human) (pPB-N-His)
PV052722 500 ng
EUR 481
GPR119 Protein Vector (Human) (pPM-C-HA)
PV052723 500 ng
EUR 481
GPR119 Protein Vector (Human) (pPM-C-His)
PV052724 500 ng
EUR 481
GPR119 Protein Vector (Mouse) (pPB-C-His)
PV185894 500 ng
EUR 603
GPR119 Protein Vector (Mouse) (pPB-N-His)
PV185895 500 ng
EUR 603
GPR119 Protein Vector (Mouse) (pPM-C-HA)
PV185896 500 ng
EUR 603
GPR119 Protein Vector (Mouse) (pPM-C-His)
PV185897 500 ng
EUR 603
GPR119 Protein Vector (Rat) (pPB-C-His)
PV271046 500 ng
EUR 603
GPR119 Protein Vector (Rat) (pPB-N-His)
PV271047 500 ng
EUR 603
GPR119 Protein Vector (Rat) (pPM-C-HA)
PV271048 500 ng
EUR 603
GPR119 Protein Vector (Rat) (pPM-C-His)
PV271049 500 ng
EUR 603
Gpr119 3'UTR Luciferase Stable Cell Line
TU205325 1.0 ml Ask for price
Gpr119 3'UTR GFP Stable Cell Line
TU158968 1.0 ml Ask for price
GPR119 3'UTR Luciferase Stable Cell Line
TU009210 1.0 ml
EUR 2333
Gpr119 3'UTR Luciferase Stable Cell Line
TU108968 1.0 ml Ask for price
GPR119 3'UTR GFP Stable Cell Line
TU059210 1.0 ml
EUR 2333
Gpr119 3'UTR GFP Stable Cell Line
TU255325 1.0 ml Ask for price
GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV629167 1.0 ug DNA
EUR 682
GPR119 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV629171 1.0 ug DNA
EUR 682
GPR119 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV629172 1.0 ug DNA
EUR 682
GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0895805 3 x 1.0 ug
EUR 376
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3605705 3 x 1.0 ug
EUR 376
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7204205 3 x 1.0 ug
EUR 376
GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0895806 1.0 ug DNA
EUR 167
GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0895807 1.0 ug DNA
EUR 167
GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0895808 1.0 ug DNA
EUR 167
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3605706 1.0 ug DNA
EUR 167
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3605707 1.0 ug DNA
EUR 167
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3605708 1.0 ug DNA
EUR 167
GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV629168 1.0 ug DNA
EUR 682
GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV629169 1.0 ug DNA
EUR 740
GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV629170 1.0 ug DNA
EUR 740
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7204206 1.0 ug DNA
EUR 167
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7204207 1.0 ug DNA
EUR 167
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7204208 1.0 ug DNA
EUR 167
Anti-Anti-SEPT2 Antibody antibody
STJ28365 100 µl
EUR 277
Anti-Anti-SEPT7 Antibody antibody
STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.
Anti-Anti-SEPT6 antibody antibody
STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.
Anti-Anti-SEPT2 Antibody antibody
STJ25475 100 µl
EUR 277
Anti-Anti-SEPT5 Antibody antibody
STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.
Anti-Anti-SEPT8 Antibody antibody
STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-Anti-SEPT9 Antibody antibody
STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.
Anti-Anti-SEPT11 Antibody antibody
STJ111530 100 µl
EUR 277
Anti-Anti-SEPT4 Antibody antibody
STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.
Anti-Anti-MARCH9 Antibody antibody
STJ112609 100 µl
EUR 277

When ought to clinicians repeat SARS-CoV-2 RT-PCR?: Repeat PCR testing concentrating on sufferers with pulmonary CT findings suggestive of COVID-19

Actual-time reverse transcription polymerase chain response (RT-PCR) testing for SARS-CoV-2 is usually repeated when clinicians suspect a false-negative consequence, however the situations beneath which repeated RT-PCR testing is warranted stay unclear.

We evaluated the apply of repeat RT-PCR testing for SARS-CoV-2 in 45 sufferers who retested after an preliminary damaging PCR take a look at. Of those, the analysis of coronavirus illness (COVID-19) was confirmed in 4 sufferers with typical chest computed tomography (CT) findings, and one affected person with out typical CT findings in whom the take a look at consequence was strongly suspected to be false constructive. We suggest repeat RT-PCR just for sufferers with typical CT findings of COVID-19.

A survey of gastrointestinal nematode species in purple deer (Cervus elaphus) farms in New Zealand utilizing PCR

Gastrointestinal nematodes are recognised as an animal well being concern for farmed purple deer. The intention of this research was to discover the vary of species infecting farmed deer herds and their farm-level prevalence in New Zealand. Faecal samples have been collected from 12-24-month-old deer (n = 6-26; imply 19) on 59 farms situated within the North (n = 25) and South (n = 34) Islands. Sub-samples of faeces have been pooled by farm and cultured to recuperate third stage larvae. Twenty 4 larvae have been randomly chosen and recognized to species utilizing a multiplex PCR (complete = 1217 larvae).

  • At farm-level probably the most prevalent nematodes have been Oesophagostomum venulosum 83% (n = 49) and the deer-specific nematodes within the subfamily Ostertagiinae (=Ostertagia-type) together with, Spiculoptera asymmetrica 73% (n = 43), Ostertagia leptospicularis 47% (n = 28), Spiculoptera spiculoptera 47% (n = 28).
  • The not too long ago recognized Trichostrongylus askivali was current on 32% (n = 19) of the farms and Oesophagostomum sikae on 17% (n = 10). Within the evaluation of the overall variety of larvae recognized, the proportion was in related order, 45% (n = 548) have been O. venulosum, 14% (n = 173) S. asymmetrica, 10% (n = 124) S. spiculoptera, 9% (n = 114) O. leptospicularis, T. askivali, 3% (n = 40) and solely 2% have been O. sikae (n = 20).
  • This research is the primary to point out the farm-level prevalence of nematode species in deer in New Zealand and the primary to make use of PCR as a diagnostic device.
  • It offers knowledge in step with cross-infection from sheep/cattle to deer, and offered tentative insights into the proportions of the principle GIN species throughout the deer inhabitants together with O. sikae and T. askivali which have solely not too long ago been recognized in New Zealand.

anti-GPCR GPR110

YF-PA22868 50 ug
EUR 363
Description: Mouse polyclonal to GPCR GPR110

GPR110 antibody

70R-31396 100 ug
EUR 327
Description: Rabbit polyclonal GPR110 antibody

GPR110 Antibody

44961-100ul 100ul
EUR 252

GPR110 Antibody

44961-50ul 50ul
EUR 187

GPR110 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR110. Recognizes GPR110 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000

GPR110 Antibody

DF2796 200ul
EUR 304
Description: GPR110 antibody detects endogenous levels of total GPR110.

GPR110 Antibody

DF4891 200ul
EUR 304
Description: GPR110 Antibody detects endogenous levels of total GPR110.

GPR110 antibody

70R-51217 100 ul
EUR 244
Description: Purified Polyclonal GPR110 antibody

GPR110 Antibody

ABD2796 100 ug
EUR 438

GPR110 Antibody

ABD4891 100 ug
EUR 438

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Polyclonal GPR110 Antibody

APR12205G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR110 . This antibody is tested and proven to work in the following applications:

GPR110 Conjugated Antibody

C44961 100ul
EUR 397

GPR110 Polyclonal Antibody

ABP51449-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ABP51449-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ABP51449-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ES2448-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 Polyclonal Antibody

ES2448-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR110 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR110 Blocking Peptide

DF2796-BP 1mg
EUR 195

GPR110 Blocking Peptide

DF4891-BP 1mg
EUR 195

GPR110 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Mouse GPR110 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR110 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

GPR110 ORF Vector (Human) (pORF)

ORF020338 1.0 ug DNA
EUR 405

Gpr110 ORF Vector (Mouse) (pORF)

ORF046467 1.0 ug DNA
EUR 506

G Protein-Coupled Receptor 110 (GPR110) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gpr110 sgRNA CRISPR Lentivector set (Mouse)

K3842201 3 x 1.0 ug
EUR 339

GPR110 sgRNA CRISPR Lentivector set (Human)

K0894901 3 x 1.0 ug
EUR 339

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3842202 1.0 ug DNA
EUR 154

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3842203 1.0 ug DNA
EUR 154

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3842204 1.0 ug DNA
EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 1)

K0894902 1.0 ug DNA
EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 2)

K0894903 1.0 ug DNA
EUR 154

GPR110 sgRNA CRISPR Lentivector (Human) (Target 3)

K0894904 1.0 ug DNA
EUR 154

GPR110 Protein Vector (Mouse) (pPB-C-His)

PV185866 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPB-N-His)

PV185867 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPM-C-HA)

PV185868 500 ng
EUR 1065

GPR110 Protein Vector (Mouse) (pPM-C-His)

PV185869 500 ng
EUR 1065

GPR110 Protein Vector (Human) (pPB-C-His)

PV081349 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPB-N-His)

PV081350 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPM-C-HA)

PV081351 500 ng
EUR 552

GPR110 Protein Vector (Human) (pPM-C-His)

PV081352 500 ng
EUR 552

Gpr110 3'UTR Luciferase Stable Cell Line

TU108961 1.0 ml Ask for price

Gpr110 3'UTR GFP Stable Cell Line

TU158961 1.0 ml Ask for price

GPR110 3'UTR GFP Stable Cell Line

TU059201 1.0 ml
EUR 1521

GPR110 3'UTR Luciferase Stable Cell Line

TU009201 1.0 ml
EUR 1521

Mouse G- protein coupled receptor 110, Gpr110 ELISA KIT

ELI-09748m 96 Tests
EUR 865

Human Probable G- protein coupled receptor 110, GPR110 ELISA KIT

ELI-08749h 96 Tests
EUR 824

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3842205 3 x 1.0 ug
EUR 376

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0894905 3 x 1.0 ug
EUR 376

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3842206 1.0 ug DNA
EUR 167

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3842207 1.0 ug DNA
EUR 167

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3842208 1.0 ug DNA
EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0894906 1.0 ug DNA
EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0894907 1.0 ug DNA
EUR 167

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0894908 1.0 ug DNA
EUR 167

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody

A06562 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody

A06569 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody

A06585-1 100ul
EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody

A06587 100ug/vial
EUR 294

Anti-GluR8 Antibody

A06589 100ul
EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody

A06597-1 100ul
EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody

A06605-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody

A06627 100ul
EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody

A06628-2 100ug/vial
EUR 294

Anti-GP2 Antibody

A06630-1 100ug/vial
EUR 334

Anti-USP21 Antibody

A06639 100ug/200ul
EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TLK2 Antibody

A06645 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TLK2 Antibody (TLK2) detection. Tested with WB in Human, Mouse.

Anti-PPP1R3C Antibody

A06658 100ul
EUR 397
Description: Rabbit Polyclonal PPP1R3C Antibody. Validated in WB and tested in Human.

Anti-LRRK1 Antibody

A06670 100ul
EUR 397
Description: Rabbit Polyclonal LRRK1 Antibody. Validated in IF, IHC and tested in Human.

Anti-MNDA Antibody

A06675 100ul
EUR 397
Description: Rabbit Polyclonal MNDA Antibody. Validated in WB and tested in Human.

Anti-KAL1 Antibody

A06684 100ul
EUR 397
Description: Rabbit Polyclonal KAL1 Antibody. Validated in WB and tested in Human.

Anti-COL14A1 Antibody

A06685 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for COL14A1 Antibody (COL14A1) detection.tested for IHC in Human, Mouse, Rat.

Anti-CYP4B1 Antibody

A06690 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYP4B1 Antibody (CYP4B1) detection.tested for WB in Human.

Anti-RFX2 Antibody

A06709 100ul
EUR 397
Description: Rabbit Polyclonal RFX2 Antibody. Validated in IHC and tested in Human.

Anti-GPR92 Antibody

A06721 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPR92 Antibody (LPAR5) detection. Tested for WB, IHC, IF in Human.

Anti-MBTPS1 Antibody

A06735 100ul
EUR 397
Description: Rabbit Polyclonal MBTPS1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PLA2G1B Antibody

A06738 100ug/200ul
EUR 397
Description: Goat Polyclonal PLA2G1B Antibody. Validated in WB and tested in Human.

Anti-GNB5 Antibody

A06754 100ul
EUR 397
Description: Rabbit Polyclonal GNB5 Antibody. Validated in IHC, WB and tested in Human.

Anti-BAIAP2L1 Antibody

A06770 100ul
EUR 397
Description: Rabbit Polyclonal BAIAP2L1 Antibody. Validated in WB and tested in Human.

Anti-IRTKS Antibody

A06770-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for IRTKS Antibody (BAIAP2L1) detection.tested for WB in Human, Mouse, Rat.

Anti-MLF1 Antibody

A06772 100ul
EUR 397
Description: Rabbit Polyclonal MLF1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-NDR2 Antibody

A06774 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NDR2 Antibody (STK38L) detection.tested for WB in Human, Mouse, Rat.

Anti-LARG Antibody

A06802-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for LARG Antibody (ARHGEF12) detection. Tested with WB in Human, Mouse, Rat.

Anti-GAS1 Antibody

A06815-1 100ul
EUR 397
Description: Rabbit Polyclonal GAS1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-APLF Antibody

A06828-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for APLF Antibody (APLF) detection.tested for WB in Human, Mouse.

Anti-PKCB1 Antibody

A06830 100ul
EUR 397
Description: Rabbit Polyclonal PKCB1 Antibody. Validated in WB and tested in Human.

Anti-DnaJB4 Antibody

A06835-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for DnaJB4 Antibody (DNAJB4) detection.tested for WB in Human, Mouse, Rat.

Anti-ArfGAP3 Antibody

A06839 100uL
EUR 455
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-SCN2B Antibody

A06842 100ul
EUR 397
Description: Rabbit Polyclonal SCN2B Antibody. Validated in WB and tested in Human.

Anti-CD316 Antibody

A06844 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD316 Antibody (IGSF8) detection. Tested with WB in Human, Mouse.

Anti-AMOTL2 Antibody

A06852 100ug/vial
EUR 294

Anti-POM121 Antibody

A06856 100ul
EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-TBX22 Antibody

A06861 100ul
EUR 397
Description: Rabbit Polyclonal TBX22 Antibody. Validated in WB and tested in Human.

Anti-QORX Antibody

A06870 100ul
EUR 397
Description: Rabbit Polyclonal QORX Antibody. Validated in WB and tested in Human.

Anti-ADAM28 Antibody

A06873-1 100ug/vial
EUR 294

Anti-Adam28 Antibody

A06873-2 100ug/vial
EUR 334

Anti-KSR2 Antibody

A06876 100ul
EUR 397
Description: Rabbit Polyclonal KSR2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-Recoverin Antibody

A06882 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Recoverin Antibody (RCVRN) detection.tested for WB in Human, Mouse.

Anti-CRP1 Antibody

A06894 100ul
EUR 397
Description: Rabbit Polyclonal CRP1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-CD297 Antibody

A06913 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD297 Antibody (ART4) detection.tested for IHC in Human.

Anti-TAF12 Antibody

A06944-1 100ug/vial
EUR 334

Anti-AKR7A2 Antibody

A06949-1 100ug/vial
EUR 334

Anti-IPMK Antibody

A06955 100ul
EUR 397
Description: Rabbit Polyclonal IPMK Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-ARHGEF10 Antibody

A06958 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ARHGEF10 Antibody (ARHGEF10) detection.tested for WB in Human, Monkey.

Anti-BMP10 Antibody

A06968 100ul
EUR 397
Description: Rabbit Polyclonal BMP10 Antibody. Validated in WB and tested in Human.

Leave a Reply

Your email address will not be published. Required fields are marked *