Repeat PCR testing concentrating on sufferers with pulmonary CT findings suggestive

Frequency of serological non-responders and false-negative RT-PCR leads to SARS-CoV-2 testing: a population-based research

Aims The sensitivity of molecular and serological strategies for COVID-19 testing in an epidemiological setting is just not effectively described. The intention of the research was to find out the frequency of damaging RT-PCR outcomes at first scientific presentation in addition to damaging serological outcomes after a follow-up of at the least Three weeks. Strategies Amongst all sufferers seen for suspected COVID-19 in Liechtenstein (n=1921), we included initially RT-PCR constructive index sufferers (n=85) in addition to initially RT-PCR damaging (n=66) for follow-up with SARS-CoV-2 antibody testing.

Antibodies have been detected with seven completely different commercially accessible immunoassays. Frequencies of damaging RT-PCR and serology leads to people with COVID-19 have been decided and in comparison with these noticed in a validation cohort of Swiss sufferers (n=211).

Outcomes Amongst COVID-19 sufferers in Liechtenstein, false-negative RT-PCR at preliminary presentation was seen in 18% (12/66), whereas damaging serology in COVID-19 sufferers was 4% (3/85). The validation cohort confirmed related frequencies: 2/66 (3%) for damaging serology, and 16/155 (10%) for false damaging RT-PCR. COVID-19 sufferers with damaging follow-up serology tended to have an extended illness length (p=0.05) and extra scientific signs than different sufferers with COVID-19 (p<0.05).

The antibody titer from quantitative immunoassays was positively related to the variety of illness signs and illness length (p<0.001). Conclusions RT-PCR at preliminary presentation in sufferers with suspected COVID-19 can miss contaminated sufferers. Antibody titers of SARS-CoV-2 assays are linked to the variety of illness signs and the length of illness. One in 25 sufferers with RT-PCR-positive COVID-19 doesn’t develop antibodies detectable with incessantly employed and commercially accessible immunoassays.

Anti-GPR119 antibody
STJ11100495 100 µl
EUR 277.00
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349.00
Polyclonal Goat Anti-GPR119 Antibody
APR16300G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR119 . This antibody is tested and proven to work in the following applications:
GPR119 antibody
70R-31399 100 ug
EUR 327.00
Description: Rabbit polyclonal GPR119 antibody
GPR119 Antibody
ABD4892 100 ug
EUR 438.00
GPR119 Antibody
DF4892 200ul
EUR 304.00
Description: GPR119 Antibody detects endogenous levels of total GPR119.
GPR119 Antibody
1-CSB-PA007283
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR119. Recognizes GPR119 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000
Gpr119/ Rat Gpr119 ELISA Kit
ELI-08203r 96 Tests
EUR 886.00
GPR119 Polyclonal Antibody
ES4819-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
GPR119 Polyclonal Antibody
ES4819-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
GPR119 Polyclonal Antibody
ABP53820-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
GPR119 Polyclonal Antibody
ABP53820-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
GPR119 Polyclonal Antibody
ABP53820-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
GPR119 Polyclonal Antibody
40973-100ul 100ul
EUR 252.00
GPR119 Polyclonal Antibody
40973-50ul 50ul
EUR 187.00
GPR119 siRNA
20-abx902267
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GPR119 siRNA
20-abx918416
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GPR119 siRNA
20-abx918417
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GPR119 Polyclonal Conjugated Antibody
C40973 100ul
EUR 397.00
GPR119 Blocking Peptide
20-abx162463
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GPR119 Rabbit pAb
A18544-100ul 100 ul
EUR 308.00
GPR119 Rabbit pAb
A18544-200ul 200 ul
EUR 459.00
GPR119 Rabbit pAb
A18544-20ul 20 ul
EUR 183.00
GPR119 Rabbit pAb
A18544-50ul 50 ul
EUR 223.00
GPR119 Blocking Peptide
DF4892-BP 1mg
EUR 195.00
GPR119 cloning plasmid
CSB-CL840575HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atggaatcatctttctcatttggagtgatccttgctgtcctggcctccctcatcattgctactaacacactagtggctgtggctgtgctgctgttgatccacaagaatgatggtgtcagtctctgcttcaccttgaatctggctgtggctgacaccttgattggtgtggccatct
  • Show more
Description: A cloning plasmid for the GPR119 gene.
Polyclonal GPR119 Antibody (aa186-235)
APR16477G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (aa186-235). This antibody is tested and proven to work in the following applications:
Polyclonal GPR119 Antibody (Cytoplasmic Domain)
APR16478G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal GPR119 Antibody (Cytoplasmic Domain)
APR16479G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280.00
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280.00
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280.00
Rat GPR119 shRNA Plasmid
20-abx989158
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human GPR119 shRNA Plasmid
20-abx965265
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse Gpr119 ELISA KIT
ELI-09750m 96 Tests
EUR 865.00
Human GPR119 ELISA KIT
ELI-48829h 96 Tests
EUR 824.00
Mouse GPR119 shRNA Plasmid
20-abx982252
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
GPR119 Recombinant Protein (Human)
RP039541 100 ug Ask for price
GPR119 Recombinant Protein (Rat)
RP203282 100 ug Ask for price
GPR119 Recombinant Protein (Mouse)
RP139418 100 ug Ask for price
G-Protein Coupled Receptor 119 (GPR119) Antibody
20-abx121407
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
G Protein-Coupled Receptor 119 (GPR119) Antibody
20-abx324143
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
G-Protein Coupled Receptor 119 (GPR119) Antibody
abx215630-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.
G-Protein Coupled Receptor 119 (GPR119) Antibody
abx432763-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.
Gpr119 ORF Vector (Rat) (pORF)
ORF067762 1.0 ug DNA
EUR 506.00
Gpr119 ORF Vector (Mouse) (pORF)
ORF046474 1.0 ug DNA
EUR 506.00
GPR119 ORF Vector (Human) (pORF)
ORF013181 1.0 ug DNA
EUR 354.00
GPR119 sgRNA CRISPR Lentivector set (Human)
K0895801 3 x 1.0 ug
EUR 339.00
Gpr119 sgRNA CRISPR Lentivector set (Mouse)
K3605701 3 x 1.0 ug
EUR 339.00
Gpr119 sgRNA CRISPR Lentivector set (Rat)
K7204201 3 x 1.0 ug
EUR 339.00
GPR119 sgRNA CRISPR Lentivector (Human) (Target 1)
K0895802 1.0 ug DNA
EUR 154.00
GPR119 sgRNA CRISPR Lentivector (Human) (Target 2)
K0895803 1.0 ug DNA
EUR 154.00
GPR119 sgRNA CRISPR Lentivector (Human) (Target 3)
K0895804 1.0 ug DNA
EUR 154.00
Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3605702 1.0 ug DNA
EUR 154.00
Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3605703 1.0 ug DNA
EUR 154.00
Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3605704 1.0 ug DNA
EUR 154.00
Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7204202 1.0 ug DNA
EUR 154.00
Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7204203 1.0 ug DNA
EUR 154.00
Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7204204 1.0 ug DNA
EUR 154.00
GPR119 Protein Vector (Human) (pPB-C-His)
PV052721 500 ng
EUR 481.00
GPR119 Protein Vector (Human) (pPB-N-His)
PV052722 500 ng
EUR 481.00
GPR119 Protein Vector (Human) (pPM-C-HA)
PV052723 500 ng
EUR 481.00
GPR119 Protein Vector (Human) (pPM-C-His)
PV052724 500 ng
EUR 481.00
GPR119 Protein Vector (Mouse) (pPB-C-His)
PV185894 500 ng
EUR 603.00
GPR119 Protein Vector (Mouse) (pPB-N-His)
PV185895 500 ng
EUR 603.00
GPR119 Protein Vector (Mouse) (pPM-C-HA)
PV185896 500 ng
EUR 603.00
GPR119 Protein Vector (Mouse) (pPM-C-His)
PV185897 500 ng
EUR 603.00
GPR119 Protein Vector (Rat) (pPB-C-His)
PV271046 500 ng
EUR 603.00
GPR119 Protein Vector (Rat) (pPB-N-His)
PV271047 500 ng
EUR 603.00
GPR119 Protein Vector (Rat) (pPM-C-HA)
PV271048 500 ng
EUR 603.00
GPR119 Protein Vector (Rat) (pPM-C-His)
PV271049 500 ng
EUR 603.00
Gpr119 3'UTR Luciferase Stable Cell Line
TU205325 1.0 ml Ask for price
Gpr119 3'UTR GFP Stable Cell Line
TU158968 1.0 ml Ask for price
GPR119 3'UTR Luciferase Stable Cell Line
TU009210 1.0 ml
EUR 2333.00
Gpr119 3'UTR Luciferase Stable Cell Line
TU108968 1.0 ml Ask for price
GPR119 3'UTR GFP Stable Cell Line
TU059210 1.0 ml
EUR 2333.00
Gpr119 3'UTR GFP Stable Cell Line
TU255325 1.0 ml Ask for price
GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV629167 1.0 ug DNA
EUR 682.00
GPR119 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV629171 1.0 ug DNA
EUR 682.00
GPR119 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV629172 1.0 ug DNA
EUR 682.00
GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0895805 3 x 1.0 ug
EUR 376.00
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3605705 3 x 1.0 ug
EUR 376.00
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7204205 3 x 1.0 ug
EUR 376.00
GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0895806 1.0 ug DNA
EUR 167.00
GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0895807 1.0 ug DNA
EUR 167.00
GPR119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0895808 1.0 ug DNA
EUR 167.00
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3605706 1.0 ug DNA
EUR 167.00
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3605707 1.0 ug DNA
EUR 167.00
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3605708 1.0 ug DNA
EUR 167.00
GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV629168 1.0 ug DNA
EUR 682.00
GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV629169 1.0 ug DNA
EUR 740.00
GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV629170 1.0 ug DNA
EUR 740.00
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7204206 1.0 ug DNA
EUR 167.00
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7204207 1.0 ug DNA
EUR 167.00
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7204208 1.0 ug DNA
EUR 167.00
Anti-Anti-SEPT2 Antibody antibody
STJ28365 100 µl
EUR 277.00
Anti-Anti-SEPT7 Antibody antibody
STJ28963 100 µl
EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.
Anti-Anti-SEPT6 antibody antibody
STJ11100949 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.
Anti-Anti-SEPT2 Antibody antibody
STJ25475 100 µl
EUR 277.00
Anti-Anti-SEPT5 Antibody antibody
STJ25477 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.
Anti-Anti-SEPT8 Antibody antibody
STJ25479 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-Anti-SEPT9 Antibody antibody
STJ111369 100 µl
EUR 277.00
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.
Anti-Anti-SEPT11 Antibody antibody
STJ111530 100 µl
EUR 277.00
Anti-Anti-SEPT4 Antibody antibody
STJ112276 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.
Anti-Anti-MARCH9 Antibody antibody
STJ112609 100 µl
EUR 277.00

When ought to clinicians repeat SARS-CoV-2 RT-PCR?: Repeat PCR testing concentrating on sufferers with pulmonary CT findings suggestive of COVID-19

Actual-time reverse transcription polymerase chain response (RT-PCR) testing for SARS-CoV-2 is usually repeated when clinicians suspect a false-negative consequence, however the situations beneath which repeated RT-PCR testing is warranted stay unclear.

We evaluated the apply of repeat RT-PCR testing for SARS-CoV-2 in 45 sufferers who retested after an preliminary damaging PCR take a look at. Of those, the analysis of coronavirus illness (COVID-19) was confirmed in 4 sufferers with typical chest computed tomography (CT) findings, and one affected person with out typical CT findings in whom the take a look at consequence was strongly suspected to be false constructive. We suggest repeat RT-PCR just for sufferers with typical CT findings of COVID-19.

A survey of gastrointestinal nematode species in purple deer (Cervus elaphus) farms in New Zealand utilizing PCR

Gastrointestinal nematodes are recognised as an animal well being concern for farmed purple deer. The intention of this research was to discover the vary of species infecting farmed deer herds and their farm-level prevalence in New Zealand. Faecal samples have been collected from 12-24-month-old deer (n = 6-26; imply 19) on 59 farms situated within the North (n = 25) and South (n = 34) Islands. Sub-samples of faeces have been pooled by farm and cultured to recuperate third stage larvae. Twenty 4 larvae have been randomly chosen and recognized to species utilizing a multiplex PCR (complete = 1217 larvae).

  • At farm-level probably the most prevalent nematodes have been Oesophagostomum venulosum 83% (n = 49) and the deer-specific nematodes within the subfamily Ostertagiinae (=Ostertagia-type) together with, Spiculoptera asymmetrica 73% (n = 43), Ostertagia leptospicularis 47% (n = 28), Spiculoptera spiculoptera 47% (n = 28).
  • The not too long ago recognized Trichostrongylus askivali was current on 32% (n = 19) of the farms and Oesophagostomum sikae on 17% (n = 10). Within the evaluation of the overall variety of larvae recognized, the proportion was in related order, 45% (n = 548) have been O. venulosum, 14% (n = 173) S. asymmetrica, 10% (n = 124) S. spiculoptera, 9% (n = 114) O. leptospicularis, T. askivali, 3% (n = 40) and solely 2% have been O. sikae (n = 20).
  • This research is the primary to point out the farm-level prevalence of nematode species in deer in New Zealand and the primary to make use of PCR as a diagnostic device.
  • It offers knowledge in step with cross-infection from sheep/cattle to deer, and offered tentative insights into the proportions of the principle GIN species throughout the deer inhabitants together with O. sikae and T. askivali which have solely not too long ago been recognized in New Zealand.

anti-GPCR GPR110

YF-PA22868 50 ug
EUR 363.00
Description: Mouse polyclonal to GPCR GPR110

GPR110 antibody

70R-51217 100 ul
EUR 244.00
Description: Purified Polyclonal GPR110 antibody

GPR110 antibody

70R-31396 100 ug
EUR 327.00
Description: Rabbit polyclonal GPR110 antibody

GPR110 Antibody

ABD2796 100 ug
EUR 438.00

GPR110 Antibody

ABD4891 100 ug
EUR 438.00

GPR110 Antibody

44961-100ul 100ul
EUR 252.00

GPR110 Antibody

44961-50ul 50ul
EUR 187.00

GPR110 Antibody

DF4891 200ul
EUR 304.00
Description: GPR110 Antibody detects endogenous levels of total GPR110.

GPR110 Antibody

DF2796 200ul
EUR 304.00
Description: GPR110 antibody detects endogenous levels of total GPR110.

GPR110 Antibody

1-CSB-PA002753
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR110. Recognizes GPR110 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349.00

GPR110 Conjugated Antibody

C44961 100ul
EUR 397.00

Polyclonal GPR110 Antibody

APR12205G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR110 . This antibody is tested and proven to work in the following applications:

GPR110 Polyclonal Antibody

ES2448-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 Polyclonal Antibody

ES2448-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against GPR110 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR110 Polyclonal Antibody

ABP51449-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ABP51449-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 Polyclonal Antibody

ABP51449-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890
  • Applications tips:
Description: A polyclonal antibody for detection of GPR110 from Human. This GPR110 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GPR110 at AA range: 810-890

GPR110 siRNA

20-abx918404
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GPR110 siRNA

20-abx918405
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GPR110 Blocking Peptide

20-abx064092
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GPR110 Blocking Peptide

DF4891-BP 1mg
EUR 195.00

GPR110 Blocking Peptide

DF2796-BP 1mg
EUR 195.00

Mouse GPR110 shRNA Plasmid

20-abx978802
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GPR110 shRNA Plasmid

20-abx966836
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280.00

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280.00

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280.00

Gpr110 ORF Vector (Mouse) (pORF)

ORF046467 1.0 ug DNA
EUR 506.00

GPR110 ORF Vector (Human) (pORF)

ORF020338 1.0 ug DNA
EUR 405.00

G Protein-Coupled Receptor 110 (GPR110) Antibody

20-abx147426
  • EUR 425.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody

20-abx007923
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 110 (GPR110) Antibody

20-abx015251
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

GPR110 sgRNA CRISPR Lentivector set (Human)

K0894901 3 x 1.0 ug
EUR 339.00

Gpr110 sgRNA CRISPR Lentivector set (Mouse)

K3842201 3 x 1.0 ug
EUR 339.00

GPR110 sgRNA CRISPR Lentivector (Human) (Target 1)

K0894902 1.0 ug DNA
EUR 154.00

GPR110 sgRNA CRISPR Lentivector (Human) (Target 2)

K0894903 1.0 ug DNA
EUR 154.00

GPR110 sgRNA CRISPR Lentivector (Human) (Target 3)

K0894904 1.0 ug DNA
EUR 154.00

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3842202 1.0 ug DNA
EUR 154.00

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3842203 1.0 ug DNA
EUR 154.00

Gpr110 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3842204 1.0 ug DNA
EUR 154.00

GPR110 Protein Vector (Human) (pPB-C-His)

PV081349 500 ng
EUR 552.00

GPR110 Protein Vector (Human) (pPB-N-His)

PV081350 500 ng
EUR 552.00

GPR110 Protein Vector (Human) (pPM-C-HA)

PV081351 500 ng
EUR 552.00

GPR110 Protein Vector (Human) (pPM-C-His)

PV081352 500 ng
EUR 552.00

GPR110 Protein Vector (Mouse) (pPB-C-His)

PV185866 500 ng
EUR 1065.00

GPR110 Protein Vector (Mouse) (pPB-N-His)

PV185867 500 ng
EUR 1065.00

GPR110 Protein Vector (Mouse) (pPM-C-HA)

PV185868 500 ng
EUR 1065.00

GPR110 Protein Vector (Mouse) (pPM-C-His)

PV185869 500 ng
EUR 1065.00

Gpr110 3'UTR GFP Stable Cell Line

TU158961 1.0 ml Ask for price

GPR110 3'UTR Luciferase Stable Cell Line

TU009201 1.0 ml
EUR 1521.00

Gpr110 3'UTR Luciferase Stable Cell Line

TU108961 1.0 ml Ask for price

GPR110 3'UTR GFP Stable Cell Line

TU059201 1.0 ml
EUR 1521.00

Mouse G- protein coupled receptor 110, Gpr110 ELISA KIT

ELI-09748m 96 Tests
EUR 865.00

Human Probable G- protein coupled receptor 110, GPR110 ELISA KIT

ELI-08749h 96 Tests
EUR 824.00

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0894905 3 x 1.0 ug
EUR 376.00

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3842205 3 x 1.0 ug
EUR 376.00

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0894906 1.0 ug DNA
EUR 167.00

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0894907 1.0 ug DNA
EUR 167.00

GPR110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0894908 1.0 ug DNA
EUR 167.00

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3842206 1.0 ug DNA
EUR 167.00

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3842207 1.0 ug DNA
EUR 167.00

Gpr110 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3842208 1.0 ug DNA
EUR 167.00

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277.00

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277.00

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277.00
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277.00

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277.00

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277.00

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277.00

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277.00

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277.00

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277.00

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277.00

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277.00

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277.00
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455.00
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.80
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.80
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.60
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

4-AEA465Hu
  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 0
  • 1
  • 2
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-HAMA Antibody

E61I006 1mg
EUR 349.00

anti- ASH2L antibody

FNab00637 100µg
EUR 505.25
  • Immunogen: ash2(absent, small, or homeotic)-like(Drosophila)
  • Uniprot ID: Q9UBL3
  • Gene ID: 9070
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against ASH2L

anti- ASIC2 antibody

FNab00638 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 1, neuronal
  • Uniprot ID: Q16515
  • Gene ID: 40
  • Research Area: Neuroscience
Description: Antibody raised against ASIC2

anti- ASIC4 antibody

FNab00639 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 4, pituitary
  • Uniprot ID: Q96FT7
  • Gene ID: 55515
  • Research Area: Neuroscience
Description: Antibody raised against ASIC4

anti- ASK1 antibody

FNab00640 100µg
EUR 505.25
  • Recommended dilution: WB: 1:100-1:1000
  • Immunogen: mitogen-activated protein kinase kinase kinase 5
  • Uniprot ID: Q99683
  • Gene ID: 4217
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ASK1

anti- ASL antibody

FNab00641 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:100-1:500
  • Immunogen: argininosuccinate lyase
  • Uniprot ID: P04424
  • Gene ID: 435
  • Research Area: Metabolism
Description: Antibody raised against ASL

anti- ASMTL antibody

FNab00642 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IP: 1:50 - 1:200
  • Immunogen: acetylserotonin O-methyltransferase-like
  • Uniprot ID: O95671
  • Gene ID: 8623
  • Research Area: Metabolism
Description: Antibody raised against ASMTL

anti- ASNA1 antibody

FNab00643 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
  • Uniprot ID: O43681
  • Gene ID: 439
  • Research Area: Metabolism
Description: Antibody raised against ASNA1

anti- ASNS antibody

FNab00644 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • Immunogen: asparagine synthetase
  • Uniprot ID: P08243
  • Gene ID: 440
  • Research Area: Metabolism
Description: Antibody raised against ASNS

anti- ASPA antibody

FNab00645 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: aspartoacylase(Canavan disease)
  • Uniprot ID: P45381
  • Gene ID: 443
  • Research Area: Metabolism
Description: Antibody raised against ASPA

anti- ASPH antibody

FNab00646 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: aspartate beta-hydroxylase
  • Uniprot ID: Q12797
  • Gene ID: 444
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ASPH

anti- ASPRV1 antibody

FNab00647 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: aspartic peptidase, retroviral-like 1
  • Uniprot ID: Q53RT3
  • Gene ID: 151516
  • Research Area: Metabolism
Description: Antibody raised against ASPRV1

anti- ASRGL1 antibody

FNab00648 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: asparaginase like 1
  • Uniprot ID: Q7L266
  • Gene ID: 80150
  • Research Area: Metabolism
Description: Antibody raised against ASRGL1

anti- ASS1 antibody

FNab00649 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:6000
  • IP: 1:500-1:3000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: argininosuccinate synthetase 1
  • Uniprot ID: P00966
  • Gene ID: 445
  • Research Area: Metabolism
Description: Antibody raised against ASS1

anti- ASS1 antibody

FNab00650 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:100-1:500
  • IF: 1:20-1:100
  • Immunogen: argininosuccinate synthetase 1
  • Uniprot ID: P00966
  • Gene ID: 445
  • Research Area: Metabolism
Description: Antibody raised against ASS1

anti- ASTL antibody

FNab00651 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: astacin-like metallo-endopeptidase(M12 family)
  • Uniprot ID: Q6HA08
  • Gene ID: 431705
  • Research Area: Stem Cells, Metabolism
Description: Antibody raised against ASTL

anti- ASTN2 antibody

FNab00652 100µg
EUR 505.25
  • Immunogen: astrotactin 2
  • Uniprot ID: O75129
  • Gene ID: 23245
  • Research Area: Metabolism
Description: Antibody raised against ASTN2

anti- ASZ1 antibody

FNab00653 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: ankyrin repeat, SAM and basic leucine zipper domain containing 1
  • Uniprot ID: Q8WWH4
  • Gene ID: 136991
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against ASZ1

anti- ATAD1 antibody

FNab00654 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:1000
  • Immunogen: ATPase family, AAA domain containing 1
  • Uniprot ID: Q8NBU5
  • Gene ID: 84896
  • Research Area: Metabolism
Description: Antibody raised against ATAD1

anti- ATAD2 antibody

FNab00655 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase family, AAA domain containing 2
  • Uniprot ID: Q6PL18
  • Gene ID: 29028
  • Research Area: Metabolism
Description: Antibody raised against ATAD2

anti- ATAD5 antibody

FNab00656 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase family, AAA domain containing 5
  • Uniprot ID: Q96QE3
  • Gene ID: 79915
  • Research Area: Metabolism
Description: Antibody raised against ATAD5

anti- ATE1 antibody

FNab00658 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: arginyltransferase 1
  • Uniprot ID: O95260
  • Gene ID: 11101
  • Research Area: Metabolism
Description: Antibody raised against ATE1

anti- ATF1 antibody

FNab00659 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: activating transcription factor 1
  • Uniprot ID: P18846
  • Gene ID: 466
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against ATF1

anti- ATF2 antibody

FNab00660 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: activating transcription factor 2
  • Uniprot ID: P15336
  • Gene ID: 1386
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Immunology
Description: Antibody raised against ATF2

anti- ATF4 antibody

FNab00662 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: activating transcription factor 4(tax-responsive enhancer element B67)
  • Uniprot ID: P18848
  • Gene ID: 468
  • Research Area: Neuroscience, Epigenetics, Meta
  • Show more
Description: Antibody raised against ATF4

anti- ATF4 antibody

FNab00663 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:2000
  • IHC: 1:50-1:300
  • IF: 1:20-1:100
  • Immunogen: activating transcription factor 4(tax-responsive enhancer element B67)
  • Uniprot ID: P18848
  • Gene ID: 468
  • Research Area: Neuroscience, Epigenetics, Metabolism, Developme
  • Show more
Description: Antibody raised against ATF4

anti- ATF6 antibody

FNab00664 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: activating transcription factor 6
  • Uniprot ID: P18850
  • Gene ID: 22926
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATF6

anti- ATF6B antibody

FNab00665 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IP:1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: activating transcription factor 6 beta
  • Uniprot ID: Q99941
  • Gene ID: 1388
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ATF6B

anti- ATG12 antibody

FNab00666 100µg
EUR 548.75
  • Immunogen: ATG12 autophagy related 12 homolog(S. cerevisiae)
  • Uniprot ID: O94817
  • Gene ID: 9140
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG12

anti- ATG12 antibody

FNab00667 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:200
  • IF: 1:10-1:100
  • Immunogen: ATG12 autophagy related 12 homolog(S. cerevisiae)
  • Uniprot ID: O94817
  • Gene ID: 9140
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG12

anti- ATG13 antibody

FNab00668 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: KIAA0652
  • Uniprot ID: O75143
  • Gene ID: 9776
  • Research Area: Epigenetics, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG13

anti- ATG16L1 antibody

FNab00669 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: ATG16 autophagy related 16-like 1
  • Uniprot ID: Q676U5
  • Gene ID: 55054
  • Research Area: Cardiovascular
Description: Antibody raised against ATG16L1

anti- ATG16L2 antibody

FNab00670 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IF: 1:50-1:500
  • Immunogen: ATG16 autophagy related 16-like 2(S. cerevisiae)
  • Uniprot ID: Q8NAA4
  • Gene ID: 89849
  • Research Area: Cardiovascular
Description: Antibody raised against ATG16L2

anti- ATG2A antibody

FNab00671 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: ATG2 autophagy related 2 homolog A
  • Uniprot ID: Q2TAZ0
  • Gene ID: 23130
  • Research Area: Cardiovascular
Description: Antibody raised against ATG2A

anti- ATG2B antibody

FNab00672 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: ATG2 autophagy related 2 homolog B(S. cerevisiae)
  • Uniprot ID: Q96BY7
  • Research Area: Cardiovascular
Description: Antibody raised against ATG2B

anti- ATG3 antibody

FNab00673 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATG3 autophagy related 3 homolog (S. cerevisiae)
  • Uniprot ID: Q9NT62
  • Gene ID: 64422
  • Research Area: Epigenetics, Cardiovascular, Metabolism
Description: Antibody raised against ATG3

anti- ATG4B antibody

FNab00674 100µg
EUR 505.25
  • Immunogen: ATG4 autophagy related 4 homolog B(S. cerevisiae)
  • Uniprot ID: Q9Y4P1
  • Gene ID: 23192
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4B

anti- ATG4C antibody

FNab00675 100µg
EUR 505.25
  • Immunogen: ATG4 autophagy related 4 homolog C(S. cerevisiae)
  • Uniprot ID: Q96DT6
  • Gene ID: 84938
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4C

anti- ATG4D antibody

FNab00676 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATG4 autophagy related 4 homolog D(S. cerevisiae)
  • Uniprot ID: Q86TL0
  • Gene ID: 84971
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATG4D

anti- ATG5 antibody

FNab00677 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: ATG5 autophagy related 5 homolog
  • Uniprot ID: Q9H1Y0
  • Gene ID: 9474
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG5

anti- ATG5 antibody

FNab00678 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:3000
  • Immunogen: ATG5 autophagy related 5 homolog(S. cerevisiae)
  • Uniprot ID: Q9H1Y0
  • Gene ID: 9474
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG5

anti- ATG7 antibody

FNab00679 100µg
EUR 548.75
  • Immunogen: ATG7 autophagy related 7 homolog(S. cerevisiae)
  • Uniprot ID: O95352
  • Gene ID: 10533
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ATG7

anti- ATGL antibody

FNab00680 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: patatin-like phospholipase domain containing 2
  • Uniprot ID: Q96AD5
  • Gene ID: 57104
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ATGL

anti- ATIC antibody

FNab00681 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IF: 1:10-1:100
  • Immunogen: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
  • Uniprot ID: P31939
  • Gene ID: 471
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ATIC

anti- ATL2 antibody

FNab00683 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: atlastin GTPase 2
  • Uniprot ID: Q8NHH9
  • Gene ID: 64225
  • Research Area: Metabolism
Description: Antibody raised against ATL2

anti- ATL3 antibody

FNab00684 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IF: 1:10-1:100
  • Immunogen: atlastin GTPase 3
  • Uniprot ID: Q6DD88
  • Gene ID: 25923
  • Research Area: Metabolism
Description: Antibody raised against ATL3

anti- ATN1 antibody

FNab00685 100µg
EUR 505.25
  • Immunogen: atrophin 1
  • Uniprot ID: P54259
  • Gene ID: 1822
  • Research Area: Neuroscience
Description: Antibody raised against ATN1

anti- ATOH1 antibody

FNab00686 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: atonal homolog 1
  • Uniprot ID: Q92858
  • Gene ID: 474
  • Research Area: Neuroscience
Description: Antibody raised against ATOH1

anti- ATP11B antibody

FNab00688 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:20 - 1:200
  • Immunogen: ATPase, class VI, type 11B
  • Uniprot ID: Q9Y2G3
  • Gene ID: 23200
  • Research Area: Metabolism
Description: Antibody raised against ATP11B

anti- ATP12A antibody

FNab00689 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: ATPase, H+/K+ transporting, nongastric, alpha polypeptide
  • Uniprot ID: P54707
  • Gene ID: 479
  • Research Area: Metabolism
Description: Antibody raised against ATP12A

Leave a Reply

Your email address will not be published. Required fields are marked *